D3 Examples - sample problems for bioinformatics class

xxxxxxxxxx
 
<!DOCTYPE html>
<head>
  <meta charset="utf-8">
  <script src="https://d3js.org/d3.v4.min.js"></script>
  <style>
    body { margin:0;position:fixed;top:0;right:0;bottom:0;left:0; }
  </style>
</head>
​
<body>
​
  <h3>Here are a few practice problems. These don't involve SVG graphics, so you should open your developer console to debug them and see their output.</h3>
  <script>
​
    // Write a function called "count_purine()" that accepts a single argument (a string of A,C,G,T) and returns the number of purine bases (A or G) in a DNA sequence string. For this one, I'll get you started.
    
    exampleInput = "CGATCGAGCTAGCTTACGTACCGGTCGTCGCGCGGGTGTATTAATGATTATATAT";
    
    count_purine = function(dna) {
      
      purine_count = 0;
      dna=dna.split("");
      dna.forEach (function (letter) {
        if (letter == "A") {purine_count = purine_count + 1;}
        else if (letter == "G") {purine_count == purine_count +1;}
       
      })
    
        return purine_count; }
       
     
     purines1= count_purine (exampleInput);
     
     console.log("purines1:", purines1 )  
        
    
    
    
    // Write a function called "percent_purine()" that accepts a single argument (a string of A,C,G,T) and returns the percentage of purine bases (A or G) in a DNA sequence string.
   //var average = "A + G"/ total
  // var total = "A + G + C +T"
    
  //  percent_purine = function (dna) {
      
    //  for (dna in exampleInput) {
        
        
      
      
      
      
    
    
    // Write a function called "find_purine_rich()" that accepts a single argument (an array of strings of A,C,G,T) and returns a new array that contains only those strings from the input array that contain at least 10 purines and are composed of at least 75% purine bases.
​
  </script>
</body>
​
    